DOE Joint Genome Institute

  • COVID-19
  • About Us
  • Contact Us
  • Our Science
    • DOE Mission Areas
    • Science Programs
    • Science Highlights
    • Scientists
    A vertical tree stump outdoors with about a dozen shiitake mushrooms sprouting from its surface.
    Tracing the Evolution of Shiitake Mushrooms
    Understanding Lentinula genomes and their evolution could provide strategies for converting plant waste into sugars for biofuel production. Additionally, these fungi play a role in the global carbon cycle.

    More

    Soil Virus Offers Insight into Maintaining Microorganisms
    Through a collaborative effort, researchers have identified a protein in soil viruses that may promote soil health.

    More

    Data yielded from RIViT-seq increased the number of sigma factor-gene pairs confirmed in Streptomyces coelicolor from 209 to 399. Here, grey arrows denote previously known regulation and red arrows are regulation identified by RIViT-seq; orange nodes mark sigma factors while gray nodes mark other genes. (Otani, H., Mouncey, N.J. Nat Commun 13, 3502 (2022). https://doi.org/10.1038/s41467-022-31191-w)
    Streamlining Regulon Identification in Bacteria
    Regulons are a group of genes that can be turned on or off by the same regulatory protein. RIViT-seq technology could speed up associating transcription factors with their target genes.

    More

  • Our Projects
    • Search JGI Projects
    • DOE Metrics/Statistics
    • Approved User Proposals
    • Legacy Projects
    A panoramic view of a lake reflecting a granite mountain.
    Genome Insider: Methane Makers in Yosemite’s Lakes
    Meet researchers who sampled the microbial communities living in the mountaintop lakes of the Sierra Nevada mountains to see how climate change affects freshwater ecosystems, and how those ecosystems work.

    Listen

    A light green shrub with spiny leaves, up close.
    Genome Insider: A Shrubbier Version of Rubber
    Hear from the consortium working on understanding the guayule plant's genome, which could lead to an improved natural rubber plant.

    Listen

    The switchgrass diversity panel growing at the Kellogg Biological Station in Michigan. (David Lowry)
    Mapping Switchgrass Traits with Common Gardens
    The combination of field data and genetic information has allowed researchers to associate climate adaptations with switchgrass biology.

    More

  • Data & Tools
    • IMG
    • Data Portal
    • MycoCosm
    • PhycoCosm
    • Phytozome
    • GOLD
    iPHoP image (Simon Roux)
    iPHoP: A Matchmaker for Phages and their Hosts
    Building on existing virus-host prediction approaches, a new tool combines and evaluates multiple predictions to reliably match viruses with their archaea and bacteria hosts.

    More

    Abstract image of gold lights and squares against a black backdrop
    Silver Age of GOLD Introduces New Features
    The Genomes OnLine Database makes curated microbiome metadata that follows community standards freely available and enables large-scale comparative genomics analysis initiatives.

    More

    Graphical overview of the RNA Virus MetaTranscriptomes Project. (Courtesy of Simon Roux)
    A Better Way to Find RNA Virus Needles in the Proverbial Database Haystacks
    Researchers combed through more than 5,000 data sets of RNA sequences generated from diverse environmental samples around the world, resulting in a five-fold increase of RNA virus diversity.

    More

  • User Programs
    • Calls for Proposals
    • Special Initiatives & Programs
    • Product Offerings
    • User Support
    • Policies
    • Submit a Proposal
    Green plant matter grows from the top, with the area just beneath the surface also visible as soil, root systems and a fuzzy white substance surrounding them.
    Supercharging SIP in the Fungal Hyphosphere
    Applying high-throughput stable isotope probing to the study of a particular fungi, researchers identified novel interactions between bacteria and the fungi.

    More

    Digital ID card with six headshots reads: Congratulations to our 2022 Function Genomics recipients!
    Final Round of 2022 CSP Functional Genomics Awardees
    Meet the final six researchers whose proposals were selected for the 2022 Community Science Program Functional Genomics call.

    More

    croppe image of the JGI helix sculpture
    Tips for a Winning Community Science Program Proposal
    In the Genome Insider podcast, tips to successfully avail of the JGI's proposal calls, many through the Community Science Program.

    Listen

  • News & Publications
    • News
    • Blog
    • Podcasts
    • Webinars
    • Publications
    • Newsletter
    • Logos and Templates
    • Photos
    2022 JGI-UC Merced interns (Thor Swift/Berkeley Lab)
    Exploring Possibilities: 2022 JGI-UC Merced Interns
    The 2022 UC Merced intern cohort share how their summer internship experiences have influenced their careers in science.

    More

    image from gif that shows where in the globe JGI fungal collaborators are located.
    Using Team Science to Build Communities Around Data
    As the data portals grow and evolve, the research communities further expand around them. But with two projects, communities are forming to generate high quality genomes to benefit researchers.

    More

    Cow Rumen and the Early Days of Metagenomics
    Tracing a cow rumen dataset from the lab to material for a hands-on undergraduate research course at CSU-San Marcos that has since expanded into three other universities.

    More

Archived Educator Resources
Home › Archived Educator Resources › Assembly Exercise › Computer Demo

Computer Demo

Point your browser to the National Center for Biotechnology Information’s nucleotide BLAST page. (You can get there by going to http://www.ncbi.nlm.nih.gov/ and clicking BLAST in the top navigation bar, then going to the Basic BLAST area and selecting “nucleotide blast”.) You may want to keep a window with these instructions open and open the nucleotide BLAST page directly in a new window.

Below is a list of things to do:

  1. Have the class read the longest continuous sequence located in group 1’s contig. Enter that into the “Enter accession number, gi, or FASTA sequence” textfield on the form. Alternatively you can copy the sequence from below and paste it into that window. The sequence is : CATATTGGCTGAAGACCAAGAGGGAAGAAGCAC
  2. Make sure the Database drop-down menu is set to “nucleotide collection (nr/nt).”
  3. Click the BLAST button. BLAST starts looking in GenBank (a database of genetic sequences) for sequences that match the query sequence that you entered. Not only does it look for the query sequence, but it also looks for the reverse complement.
  4. Wait about ten seconds until the results are ready.
  5. Once the results are up, scroll down the page past the alignment image and click the first link AC026748.7. This opens up a GenBank page. Note in this GenBank record that this is the sequence for Homo sapiens chromosome 5 clone RP11-325I22. In the reference portion note that the JGI did this sequence.
  6. Go back to the BLAST results page by hitting your browser’s Back button. You may have to refresh the page. On the results page go and click the next link AF119117.1. This again opens up a GenBank page that shows a GenBank record that is specific for the gene that this sequence belongs to. Copy the gene identifier SLC6A3 from the Definition section.
  7. Click the OMIM link on the top menu or go to http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=OMIM.
  8. Paste SLC6A3 into the search textfield at the top of the page and click “Go”.
  9. The results of the OMIM search show entries associated with behavior-related issues. Also point out that one of the entries shows that this gene is associated with ADHD, or attention-deficit hyperactivity disorder. If you want to find out more about ADHD, click the numeric link.
  • Student Instructions
  • Teacher Instructions
  • Sequence Quality
  • Computer Demo

More topics:

  • COVID-19 Status
  • News
  • Science Highlights
  • Blog
  • Webinars
  • CSP Plans
  • Featured Profiles
  • Careers
  • Contact Us
  • Events
  • User Meeting
  • MGM Workshops
  • Internal
  • Disclaimer
  • Credits
  • Policies
  • Emergency Info
  • Accessibility / Section 508 Statement
  • Flickr
  • LinkedIn
  • RSS
  • Twitter
  • YouTube
Lawrence Berkeley National Lab Biosciences Area
A project of the US Department of Energy, Office of Science

JGI is a DOE Office of Science User Facility managed by Lawrence Berkeley National Laboratory

© 1997-2023 The Regents of the University of California