DOE Joint Genome Institute

Archived Educator Resources
Home › Archived Educator Resources › Assembly Exercise › Computer Demo

Computer Demo

Point your browser to the National Center for Biotechnology Information’s nucleotide BLAST page. (You can get there by going to http://www.ncbi.nlm.nih.gov/ and clicking BLAST in the top navigation bar, then going to the Basic BLAST area and selecting “nucleotide blast”.) You may want to keep a window with these instructions open and open the nucleotide BLAST page directly in a new window.

Below is a list of things to do:

  1. Have the class read the longest continuous sequence located in group 1’s contig. Enter that into the “Enter accession number, gi, or FASTA sequence” textfield on the form. Alternatively you can copy the sequence from below and paste it into that window. The sequence is : CATATTGGCTGAAGACCAAGAGGGAAGAAGCAC
  2. Make sure the Database drop-down menu is set to “nucleotide collection (nr/nt).”
  3. Click the BLAST button. BLAST starts looking in GenBank (a database of genetic sequences) for sequences that match the query sequence that you entered. Not only does it look for the query sequence, but it also looks for the reverse complement.
  4. Wait about ten seconds until the results are ready.
  5. Once the results are up, scroll down the page past the alignment image and click the first link AC026748.7. This opens up a GenBank page. Note in this GenBank record that this is the sequence for Homo sapiens chromosome 5 clone RP11-325I22. In the reference portion note that the JGI did this sequence.
  6. Go back to the BLAST results page by hitting your browser’s Back button. You may have to refresh the page. On the results page go and click the next link AF119117.1. This again opens up a GenBank page that shows a GenBank record that is specific for the gene that this sequence belongs to. Copy the gene identifier SLC6A3 from the Definition section.
  7. Click the OMIM link on the top menu or go to http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=OMIM.
  8. Paste SLC6A3 into the search textfield at the top of the page and click “Go”.
  9. The results of the OMIM search show entries associated with behavior-related issues. Also point out that one of the entries shows that this gene is associated with ADHD, or attention-deficit hyperactivity disorder. If you want to find out more about ADHD, click the numeric link.